blockUI : not working when html page is loading data
Hi,
I have a cgi script with an HTML form that processes DNA sequences from a user, aligning them against millions of other DNA sequences. That takes a while, so I want to display a waiting message while the query is being processed. My page is here :
http://www.genomequebec.mcgill.ca/compgen/vervet_research/cgi-bin/vervet_seq_db.pl
I am not sure what I am doing wrong, most of the time the message appears so briefly you can barely see it (if you're lucky it appears nicely but quickly disappears). The page gets reloaded with the results below the form, and it seems that both processes (blockUI and the program itself) are conflicting.
I am totally new to AJAX.
Any help would be greatly appreciated.
Thanks,
Jessica
To test the page, you could paste the following in the text area
>test
GTGGGAACGCGGGCGGCGAGACGGCGGCAGGGCGGCGGCAGGATGTGTGACCGAAATGGT
GGTCGGCGGCTTCGACAGTGGCTGATCGAGCAGATTGACAGTAGCATGTATCCAGGACTG
ATTTGGGAGAATGACGAGAAGAGCATGTTCCGGATCCCTTGGAAACACGCCGGCAAGCAA
and type in anything to give the file an id.